![](http://1.bp.blogspot.com/_fydvn82dy8s/SpQsF_OXl0I/AAAAAAAABOg/RDgchOzfZGA/s400/ThoughtProcessorShow.jpg)
Heads up: I'm taking part in Phoneticontrol's THOUGHT PROCESSOR group show @ Munky King on Thursday, Sept. 3. Come on down and see fun papercraft art by L.A. area artists and animators like my pals Martin Hsu, Jim Mahfood, and Robert Ryan Cory as we show off our interpretations of SF artist Phoneticontrol's creation. This is the L.A. leg of a multi-city touring show, each featuring local talent. Here's mine, combining chaos and kawaii in one iron-clad package-- "Destroyer":
![](http://4.bp.blogspot.com/_fydvn82dy8s/SpRH3yzmvEI/AAAAAAAABPw/v11TBJUY7c0/s320/TP_BrickKanji.jpg)
![](http://4.bp.blogspot.com/_fydvn82dy8s/Sp17b2hVA0I/AAAAAAAABQA/9Ebt0HLl644/s320/TP_ArtPiece_FINAL.jpg)
9.3.09 – 9.24.09
Thursday, September 3rd, 7-10pm
Munky King Gallery
7308 Melrose Ave
Los Angeles, CA
Directions are HERE.
18 comments:
I like the shapes and simplicity .. and the evil character is cool
great work chris!
i like how bold it is. simple, yet appealing. I likey!
What an awesome show idea, your entry is darling :)
Cool concept! I love the drawing, too. The word bubble speaks volumes.
so crafty!
Sweet piece, dude! Steady hands!!!
wicked cool!
Your style rules! Great stuff...
guuuuuuuuaaaaaaaaauuuuuuuu!!!!!!!!que estilo tan cartoon!!!!!very good works.
Dude, sorry i missed this show. These look awesome. the pdf thing is a great idea! spreading the cartoon love!
This is sooo cute!!! YOur little character ROCK!
I wish I read this post sooner. I would of been down to go. Your line work and designs never fails to amze me.
Waouh ! Just discovering your art ! Great, man ! I will follow...
amazing style !
Really nice! I love the style.
It's great! Like a cartoons' fan, I really loved your blog.
Hey! You're so awesome!
Awesome Design Chris...I missed another show...kidz...what'r you gonna do....Great stuff!!!
Post a Comment